shRNA Lentivirus (self-inactivating), p7SK-(Fam110b-shRNA-Seq1)(CAT#: LV-SI3913WQ)
This product is a Fam110b-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Fam110b gene may be involved in tumor progression. The expression of Fam110b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Fam110b-shRNA-Seq1 |
Related Target/Protein | Fam110b |
Region | CDS |
TargetSeq | CAGACTTGAGTGACAGGTATT |
NCBI RefSeq | NM_173426 |
Alternative Names | C8orf72 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |