shRNA Lentivirus (self-inactivating), p7SK-(C8orf44-shRNA-Seq1)(CAT#: LV-SI3217WQ)

This product is a C8orf44-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C8orf44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C8orf44-shRNA-Seq1
Related Target/Protein C8orf44
Region CDS
TargetSeq CTGAATTATCAGTCTCTCATT
NCBI RefSeq NM_019607
Titer >1*10^10 GC/mL
Target Gene
Gene ID 56260
Uniprot ID Q96CB5

Related Products