shRNA Lentivirus (self-inactivating), p7SK-(KIAA0930-shRNA-Seq1)(CAT#: LV-SI1477WQ)
This product is a KIAA0930-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of KIAA0930-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | KIAA0930-shRNA-Seq1 |
Related Target/Protein | KIAA0930 |
Region | CDS |
TargetSeq | CGTCTTCTGGACTTGGATGTT |
NCBI RefSeq | NM_015264 |
Alternative Names | LSC3; C22orf9 |
Titer | >1*10^10 GC/mL |
Related Diseases | Melanoma |