shRNA Lentivirus (self-inactivating), p7SK-(KIAA1919-shRNA-Seq1)(CAT#: LV-SI1173WQ)
This product is a KIAA1919-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA1919-shRNA-Seq1 |
| Related Target/Protein | KIAA1919 |
| Region | CDS |
| TargetSeq | GCAGGCCTTACACTTCTCTTT |
| NCBI RefSeq | NM_153369 |
| Alternative Names | NaGLT1; MFSD4B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal carcinoma |
