shRNA Lentivirus (self-inactivating), pU6-(PATL1-shRNA-Seq1)(CAT#: LV-SI0103WQ)
This product is a PATL1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | PATL1-shRNA-Seq1 |
Related Target/Protein | PATL1 |
Region | CDS |
TargetSeq | CATTACCAAGGCGGTCAACTT |
NCBI RefSeq | NM_152716 |
Alternative Names | Pat1b; hPat1b |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatitis C virus (HCV) infection |