shRNA Lentivirus (self-inactivating), p7SK-(LRRC15-shRNA-Seq2)(CAT#: LV-SI3510WQ)

This product is a LRRC15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of LRRC15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert LRRC15-shRNA-Seq2
Related Target/Protein LRRC15
Region CDS
TargetSeq CCGTCTTACTCTCTTTGGGAA
NCBI RefSeq NM_130830
Alternative Names LIB
Titer >1*10^10 GC/mL
Target Gene
Gene ID 131578
Uniprot ID Q8TF66

Related Products