shRNA Lentivirus (self-inactivating), pU6-(AARSD1-shRNA-Seq3)(CAT#: LV-SI0345WQ)
This product is a AARSD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | AARSD1-shRNA-Seq3 |
Related Target/Protein | AARSD1 |
Region | CDS |
TargetSeq | CCTGATATTTCTGTCTGGGAA |
NCBI RefSeq | NM_025267 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |