shRNA Lentivirus (self-inactivating), p7SK-(Lsm14a-shRNA-Seq3)(CAT#: LV-SI3480WQ)

Datasheet

This product is a Lsm14a-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Lsm14a-shRNA-Seq3
Related Target/Protein Lsm14a
Region CDS
TargetSeq GCAGACTTTGAATATAGGAAA
NCBI RefSeq NM_025948
Alternative Names RAP55; FAM61A; RAP55A; C19orf13
Titer >1*10^10 GC/mL
Target Gene
Gene ID 26065
Uniprot ID Q8ND56

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(SAMD8-shRNA-Seq3) (CAT#:LV-SI1444WQ) shRNA Lentivirus (self-inactivating), pH1-(OR5H15-shRNA-Seq1) (CAT#:LV-SI3002WQ) Recombinant lentivirus, pU6-(Human MTOR 3'UTR), Overexpression (CAT#:Lenti-GTOH0755WQ) shRNA Lentivirus (self-inactivating), pH1-(FAM124A-shRNA-Seq1) (CAT#:LV-SI0786WQ) Recombinant lentivirus, pU6-(Human TRABD2B(TIKI2)), Overexpression (CAT#:Lenti-GTOH0637WQ) shRNA Lentivirus (self-inactivating), pU6-(OR52E5-shRNA-Seq3) (CAT#:LV-SI1600WQ) shRNA Lentivirus (self-inactivating), pU6-(C14orf70-shRNA-Seq2) (CAT#:LV-SI0489WQ) shRNA Lentivirus (self-inactivating), pU6-(4921504E06Rik-shRNA-Seq4) (CAT#:LV-SI1821WQ)