shRNA Lentivirus (self-inactivating), p7SK-(Med18-shRNA-Seq1)(CAT#: LV-SI3578WQ)
This product is a Med18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Med18 gene is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II. The expression of Med18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Med18-shRNA-Seq1 |
Related Target/Protein | Med18 |
Region | CDS |
TargetSeq | CATGAAGGTTGTGGTGTACAA |
NCBI RefSeq | NM_026039 |
Alternative Names | SRB5; p28b |
Titer | >1*10^10 GC/mL |