shRNA Lentivirus (self-inactivating), pH1-(Cma2-shRNA-Seq1)(CAT#: LV-SI3070WQ)
This product is a Cma2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Cma2-shRNA-Seq1 |
Related Target/Protein | Cma2 |
Region | 3UTR |
TargetSeq | CATCAGAGTCTTCAAGCCAGA |
NCBI RefSeq | NM_001024714 |
Alternative Names | Mcp10 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 545055 |
Uniprot ID | A0A2I3BR33 |