shRNA Lentivirus (self-inactivating), p7SK-(MTRF1L-shRNA-Seq2)(CAT#: LV-SI1369WQ)

This product is a MTRF1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by MTRF1L gene plays a role in mitochondrial translation termination, and is thought to be a release factor that is involved in the dissociation of the complete protein from the final tRNA, the ribosome, and the cognate mRNA. The expression of MTRF1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert MTRF1L-shRNA-Seq2
Related Target/Protein MTRF1L
Region CDS
TargetSeq CGCTGCATGATCTTGAAACTT
NCBI RefSeq NM_019041
Alternative Names MRF1L; HMRF1L; mtRF1a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54516
Uniprot ID Q9UGC7

Related Products