shRNA Lentivirus (self-inactivating), p7SK-(OR4K5-shRNA-Seq6)(CAT#: LV-SI3407WQ)
This product is a OR4K5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR4K5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4K5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | OR4K5-shRNA-Seq6 |
Related Target/Protein | OR4K5 |
Region | CDS |
TargetSeq | GCTACTTGTTTCGATGGCCTA |
NCBI RefSeq | NM_001005483 |
Alternative Names | OR14-16 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |