shRNA Lentivirus (self-inactivating), p7SK-(OR5H15-shRNA-Seq2)(CAT#: LV-SI3853WQ)

This product is a OR5H15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The OR5H15 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5H15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert OR5H15-shRNA-Seq2
Related Target/Protein OR5H15
Region CDS
TargetSeq GTATTCAGCATTGTGACTATT
NCBI RefSeq NM_001005515
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 403274
Uniprot ID A6NDH6

Related Products