shRNA Lentivirus (self-inactivating), p7SK-(PATL1-shRNA-Seq3)(CAT#: LV-SI1107WQ)

This product is a PATL1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The PATL1 gene encodes a involved in deadenylation-dependent decapping of mRNAs, leading to the degradation of mRNAs. Acts as a scaffold protein that connects deadenylation and decapping machinery. The expression of PATL1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PATL1-shRNA-Seq3
Related Target/Protein PATL1
Region 3UTR
TargetSeq GCCATCACCAATGGAGTGTTT
NCBI RefSeq NM_152716
Alternative Names Pat1b; hPat1b
Titer >1*10^10 GC/mL
Related Diseases Hepatitis C virus (HCV) infection
Target Gene
Gene ID 219988
Uniprot ID Q86TB9

Related Products