shRNA Lentivirus (self-inactivating), pU6-(FAM171A1-shRNA-Seq2)(CAT#: LV-SI0188WQ)
This product is a FAM171A1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FAM171A1 gene is involved in the regulation of the cytoskeletal dynamics and plays a role in actin stress fiber formation. The expression of FAM171A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | FAM171A1-shRNA-Seq2 |
Related Target/Protein | FAM171A1 |
Region | CDS |
TargetSeq | CGGAAGTAATGATGCCAGTTT |
NCBI RefSeq | NM_001010924 |
Alternative Names | APCN; C10orf38 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |