shRNA Lentivirus (self-inactivating), p7SK-(Pramel1-shRNA-Seq1)(CAT#: LV-SI3999WQ)
This product is a Pramel1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pramel1 gene may play a role in acrosome development and also in sperm maturation and motility. The expression of Pramel1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Pramel1-shRNA-Seq1 |
| Related Target/Protein | Pramel1 |
| Region | CDS |
| TargetSeq | CTACAGGAGAATCTTAGAGAT |
| NCBI RefSeq | NM_031377 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |
