shRNA Lentivirus (self-inactivating), p7SK-(Rufy2-shRNA-Seq2)(CAT#: LV-SI3644WQ)
This product is a Rufy2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Rufy2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Rufy2-shRNA-Seq2 |
Related Target/Protein | Rufy2 |
Region | CDS |
TargetSeq | CTTTGCAAGAAGATCTTCAAA |
NCBI RefSeq | NM_027425 |
Alternative Names | RABIP4R; ZFYVE13 |
Titer | >1*10^10 GC/mL |