shRNA Lentivirus (self-inactivating), p7SK-(GLOD4-shRNA-Seq1)(CAT#: LV-SI1144WQ)
This product is a GLOD4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | GLOD4-shRNA-Seq1 |
| Related Target/Protein | GLOD4 |
| Region | 3UTR |
| TargetSeq | CCCTCTTACTTGCTTTCACAT |
| NCBI RefSeq | NM_016080 |
| Alternative Names | HC71; CGI-150; C17orf25 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular carcinoma |
