shRNA Lentivirus (self-inactivating), p7SK-(SEC63D1-shRNA-Seq1)(CAT#: LV-SI1370WQ)
This product is a SEC63D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SEC63D1 gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. The expression of SEC63D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SEC63D1-shRNA-Seq1 |
Related Target/Protein | SEC63D1 |
Region | CDS |
TargetSeq | GCAAGGGAACTTGAATTGATT |
NCBI RefSeq | NM_198550 |
Alternative Names | MER3; POF9; Si-11; HFM1; Si-11-6; helicase |
Titer | >1*10^10 GC/mL |
Related Diseases | Premature ovarian failure 9 (POF9) |