shRNA Lentivirus (self-inactivating), p7SK-(SH3BP5-shRNA-Seq1)(CAT#: LV-SI1438WQ)
This product is a SH3BP5-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SH3BP5 gene functions as guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. The expression of SH3BP5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SH3BP5-shRNA-Seq1 |
Related Target/Protein | SH3BP5 |
Region | CDS |
TargetSeq | CCTTTGAAGATGACAGCTGTA |
NCBI RefSeq | NM_004844 |
Alternative Names | SAB; SH3BP-5 |
Titer | >1*10^10 GC/mL |
Related Diseases | Acute Liver Failure |