shRNA Lentivirus (self-inactivating), p7SK-(Tmem146-shRNA-Seq2)(CAT#: LV-SI3677WQ)
This product is a Tmem146-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Tmem146 gene encodes auxiliary component of the CatSper complex, a complex involved in sperm cell hyperactivation. The expression of Tmem146-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Tmem146-shRNA-Seq2 |
Related Target/Protein | Tmem146 |
Region | CDS |
TargetSeq | CAGACAAACAACAAGATTATT |
NCBI RefSeq | XM_001052081 |
Alternative Names | CATSPERD |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |