shRNA Lentivirus (self-inactivating), p7SK-(TMEM60-shRNA-Seq2)(CAT#: LV-SI1234WQ)

This product is a TMEM60-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of TMEM60-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TMEM60-shRNA-Seq2
Related Target/Protein TMEM60
Region CDS
TargetSeq CGACATGGATCACACAATATT
NCBI RefSeq NM_032936
Alternative Names DC32; C7orf35
Titer >1*10^10 GC/mL
Related Diseases Kidney function and chronic kidney disease
Target Gene
Gene ID 85025
Uniprot ID Q9H2L4

Related Products