shRNA Lentivirus (self-inactivating), p7SK-(TTC18-shRNA-Seq1)(CAT#: LV-SI1114WQ)
This product is a TTC18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TTC18-shRNA-Seq1 |
Related Target/Protein | TTC18 |
Region | CDS |
TargetSeq | CAAGAGTTCCTCTGGTCACTA |
NCBI RefSeq | NM_145170 |
Alternative Names | CFAP70 |
Titer | >1*10^10 GC/mL |
Related Diseases | Outer dynein arm (ODA) |