shRNA Lentivirus (self-inactivating), p7SK-(TTC18-shRNA-Seq2)(CAT#: LV-SI1115WQ)

This product is a TTC18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TTC18-shRNA-Seq2
Related Target/Protein TTC18
Region CDS
TargetSeq CCTCCTAACTGAAGACAACAT
NCBI RefSeq NM_145170
Alternative Names CFAP70
Titer >1*10^10 GC/mL
Related Diseases Outer dynein arm (ODA)
Target Gene
Gene ID 118491
Uniprot ID Q5T0N1

Related Products