shRNA Lentivirus (self-inactivating), p7SK-(XKR6-shRNA-Seq1)(CAT#: LV-SI3696WQ)

This product is a XKR6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert XKR6-shRNA-Seq1
Related Target/Protein XKR6
Region CDS
TargetSeq CCTCTATGAGTTGCTACAGTA
NCBI RefSeq NM_173683
Alternative Names XRG6; C8orf5; C8orf7; C8orf21
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286046
Uniprot ID Q5GH73

Related Products