shRNA Lentivirus (self-inactivating), p7SK-(XKR6-shRNA-Seq1)(CAT#: LV-SI3696WQ)
This product is a XKR6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | XKR6-shRNA-Seq1 |
Related Target/Protein | XKR6 |
Region | CDS |
TargetSeq | CCTCTATGAGTTGCTACAGTA |
NCBI RefSeq | NM_173683 |
Alternative Names | XRG6; C8orf5; C8orf7; C8orf21 |
Titer | >1*10^10 GC/mL |