shRNA Lentivirus (self-inactivating), p7SK-(Zfp36l2-shRNA-Seq1)(CAT#: LV-SI3977WQ)
This product is a Zfp36l2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Zfp36l2 gene is a member of the TIS11 family of early response genes. The expression of Zfp36l2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Zfp36l2-shRNA-Seq1 |
Related Target/Protein | Zfp36l2 |
Region | CDS |
TargetSeq | CAAACCTCAATCTGAACAACA |
NCBI RefSeq | NM_001001806 |
Alternative Names | BRF2; ERF2; ERF-2; TIS11D; RNF162C |
Titer | >1*10^10 GC/mL |
Related Diseases | T-cell acute lymphoblastic leukemia (T-ALL) |