shRNA Lentivirus (self-inactivating), p7SK-(Zmynd12-shRNA-Seq3)(CAT#: LV-SI3517WQ)

This product is a Zmynd12-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Zmynd12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Zmynd12-shRNA-Seq3
Related Target/Protein Zmynd12
Region CDS
TargetSeq GAATATCTATCCCAAGCCCAA
NCBI RefSeq NM_001014900
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84217
Uniprot ID Q9H0C1

Related Products