shRNA Lentivirus (self-inactivating), pH1-(1700065I17Rik-shRNA-Seq1)(CAT#: LV-SI2661WQ)

This product is a 1700065I17Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 1700065I17Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 1700065I17Rik-shRNA-Seq1
Related Target/Protein 1700065I17Rik
Region CDS
TargetSeq GATACCAGAGCACAGTGATTT
NCBI RefSeq NM_026099
Alternative Names Tex43, Tseg7
Titer >1*10^10 GC/mL
Related Diseases Testis disease
Target Gene
Gene ID 67343
Uniprot ID C9W8M4

Related Products