shRNA Lentivirus (self-inactivating), pU6-(NSMAF-shRNA-Seq2)(CAT#: LV-SI1710WQ)

This product is a NSMAF-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The NSMAF gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor and may play a role in regulating TNF-induced cellular responses such as inflammation. The expression of NSMAF-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert NSMAF-shRNA-Seq2
Related Target/Protein NSMAF
Region CDS
TargetSeq CAGTTACACGAGCACTATAAA
NCBI RefSeq NM_003580
Alternative Names FAN; GRAMD5
Titer >1*10^10 GC/mL
Related Diseases Inflammation
Target Gene
Gene ID 8439
Uniprot ID Q92636

Related Products