shRNA Lentivirus (self-inactivating), pH1-(1700120K04Rik-shRNA-Seq1)(CAT#: LV-SI3197WQ)
This product is a 1700120K04Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 1700120K04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | 1700120K04Rik-shRNA-Seq1 |
| Related Target/Protein | 1700120K04Rik |
| Region | CDS |
| TargetSeq | GAAGGTACTACTGTGGCTAAG |
| NCBI RefSeq | NM_026628 |
| Titer | >1*10^10 GC/mL |
