shRNA Lentivirus (self-inactivating), pH1-(9130011J15Rik-shRNA-Seq1)(CAT#: LV-SI2565WQ)

Datasheet

This product is a 9130011J15Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 9130011J15Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 9130011J15Rik-shRNA-Seq1
Related Target/Protein 9130011J15Rik
Region CDS
TargetSeq CACTGTGGAATGTGTTCATGA
NCBI RefSeq NM_172396
Alternative Names Smim7
Titer >1*10^10 GC/mL
Target Gene
Gene ID 66818
Uniprot ID F8WIU9

Related Products

Recombinant lentivirus, pU6-(Domestic silkworm shd 3'UTR), Overexpression (CAT#:Lenti-GTOH0494WQ) shRNA Lentivirus (self-inactivating), p7SK-(MAP6D1-shRNA-Seq2) (CAT#:LV-SI1200WQ) Recombinant lentivirus, pU6-(Human HGF), Overexpression (CAT#:Lenti-GTOH0213WQ) shRNA Lentivirus (self-inactivating), pH1-(APBA3-shRNA-Seq1) (CAT#:LV-SI0812WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR8I2-shRNA-Seq1) (CAT#:LV-SI3396WQ) shRNA Lentivirus (self-inactivating), pH1-(TMEM177-shRNA-Seq3) (CAT#:LV-SI2656WQ) shRNA Lentivirus (self-inactivating), p7SK-(BC052040-shRNA-Seq1) (CAT#:LV-SI4043WQ) Recombinant lentivirus, pU6-(Human CDK8 3'UTR), Overexpression (CAT#:Lenti-GTOH0562WQ)