shRNA Lentivirus (self-inactivating), p7SK-(MAP6D1-shRNA-Seq2)(CAT#: LV-SI1200WQ)
This product is a MAP6D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | MAP6D1-shRNA-Seq2 |
Related Target/Protein | MAP6D1 |
Region | CDS |
TargetSeq | CCTCAAGATCCACAAAGACAA |
NCBI RefSeq | NM_024871 |
Alternative Names | SL21; MAPO6D1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal cancer |