shRNA Lentivirus (self-inactivating), pH1-(BEST1-shRNA-Seq1)(CAT#: LV-SI0736WQ)

This product is a BEST1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BEST1 gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. The expression of BEST1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert BEST1-shRNA-Seq1
Related Target/Protein BEST1
Region CDS
TargetSeq GACTCTGTATTGCGACAGCTA
NCBI RefSeq NM_004183
Alternative Names ARB; BMD; BEST; RP50; VMD2; TU15B; Best1V1Delta2
Titer >1*10^10 GC/mL
Related Diseases Macular Dystrophy
Target Gene
Gene ID 7439
Uniprot ID O76090

Related Products