shRNA Lentivirus (self-inactivating), pH1-(C14orf70-shRNA-Seq3)(CAT#: LV-SI0991WQ)
This product is a C14orf70-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C14orf70-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C14orf70-shRNA-Seq3 |
Related Target/Protein | C14orf70 |
Region | 3UTR |
TargetSeq | GAGCTCAGAAAGCTAAAGCAA |
NCBI RefSeq | NM_001007560 |
Alternative Names | LINC00523 |
Titer | >1*10^10 GC/mL |
Related Diseases | Type 2 diabetes |