shRNA Lentivirus (self-inactivating), pU6-(Bex2-shRNA-Seq1)(CAT#: LV-SI2238WQ)
This product is a Bex2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Bex2 gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. The expression of Bex2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Bex2-shRNA-Seq1 |
Related Target/Protein | Bex2 |
Region | 3UTR |
TargetSeq | GTTTGTGATGTACTGTTGTAA |
NCBI RefSeq | NM_009749 |
Alternative Names | BEX1; DJ79P11.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |