shRNA Lentivirus (self-inactivating), pH1-(C16orf62-shRNA-Seq2)(CAT#: LV-SI0987WQ)

This product is a C16orf62-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C16orf62 gene acts as component of the retriever complex. The expression of C16orf62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C16orf62-shRNA-Seq2
Related Target/Protein C16orf62
Region CDS
TargetSeq GATAGAGATGATAACTCCGTT
NCBI RefSeq NM_020314
Alternative Names VPS35L
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 57020
Uniprot ID Q7Z3J2

Related Products