shRNA Lentivirus (self-inactivating), pH1-(C20orf43-shRNA-Seq1B)(CAT#: LV-SI2851WQ)

This product is a C20orf43-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C20orf43 gene may be required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication and function to facilitate fork pausing at replication fork barriers like the rDNA. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C20orf43-shRNA-Seq1B
Related Target/Protein C20orf43
Region CDS
TargetSeq GTACTCTAAGTCAGGAAATAT
NCBI RefSeq NM_016407
Alternative Names CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51507
Uniprot ID Q9BY42

Related Products