shRNA Lentivirus (self-inactivating), pH1-(C22orf39-shRNA-Seq2)(CAT#: LV-SI0909WQ)

This product is a C22orf39-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C22orf39-shRNA-Seq2
Related Target/Protein C22orf39
Region 3UTR
TargetSeq GACACACAGGTGGGTCATAAT
NCBI RefSeq NM_173793
Titer >1*10^10 GC/mL
Related Diseases Liver cancer
Target Gene
Gene ID 128977
Uniprot ID Q6P5X5

Related Products