shRNA Lentivirus (self-inactivating), pH1-(CASC4-shRNA-Seq1)(CAT#: LV-SI0617WQ)

This product is a CASC4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The increased expression level of CASC4 gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. The expression of CASC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CASC4-shRNA-Seq1
Related Target/Protein CASC4
Region CDS
TargetSeq GATGATGAAGAACGAGAGCTT
NCBI RefSeq NM_138423
Alternative Names H63
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancers, Breast cancer
Target Gene
Gene ID 113201
Uniprot ID Q6P4E1

Related Products