shRNA Lentivirus (self-inactivating), pH1-(CA3-shRNA-Seq1)(CAT#: LV-SI0758WQ)

This product is a CA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CA3 is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. The expression of CA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CA3-shRNA-Seq1
Related Target/Protein CA3
Region CDS
TargetSeq CCCGTTGAGCTGCATACTAAA
NCBI RefSeq NM_005181
Alternative Names Car3; CAIII
Titer >1*10^10 GC/mL
Related Diseases Duchenne muscle dystrophy
Target Gene
Gene ID 761
Uniprot ID P07451

Related Products