shRNA Lentivirus (self-inactivating), pH1-(CIAPIN1-shRNA-Seq2)(CAT#: LV-SI0776WQ)

This product is a CIAPIN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CIAPIN1-shRNA-Seq2
Related Target/Protein CIAPIN1
Region 3UTR
TargetSeq GCAGAACTCTGAACGACAATA
NCBI RefSeq NM_020313
Alternative Names DRE2; CIAE2; PRO0915; Anamorsin
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 57019
Uniprot ID Q6FI81

Related Products