shRNA Lentivirus (self-inactivating), pH1-(CRAMP1L-shRNA-Seq1)(CAT#: LV-SI0881WQ)
This product is a CRAMP1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CRAMP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CRAMP1L-shRNA-Seq1 |
| Related Target/Protein | CRAMP1L |
| Region | CDS |
| TargetSeq | GATTACATTTCTCGGTTCAAT |
| NCBI RefSeq | NM_020825 |
| Alternative Names | HN1L; TCE4; CRAMP1L |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lamotrigine (LTG)-induced maculopapular eruption (MPE) |
