shRNA Lentivirus (self-inactivating), pH1-(CRAMP1L-shRNA-Seq1)(CAT#: LV-SI0881WQ)
This product is a CRAMP1L-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of CRAMP1L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CRAMP1L-shRNA-Seq1 |
Related Target/Protein | CRAMP1L |
Region | CDS |
TargetSeq | GATTACATTTCTCGGTTCAAT |
NCBI RefSeq | NM_020825 |
Alternative Names | HN1L; TCE4; CRAMP1L |
Titer | >1*10^10 GC/mL |
Related Diseases | Lamotrigine (LTG)-induced maculopapular eruption (MPE) |