shRNA Lentivirus (self-inactivating), pH1-(ENSMUSG00000063277-shRNA-Seq1)(CAT#: LV-SI3045WQ)
This product is a ENSMUSG00000063277-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of ENSMUSG00000063277-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ENSMUSG00000063277-shRNA-Seq1 |
Related Target/Protein | ENSMUSG00000063277 |
Region | CDS |
TargetSeq | GAAGACAATGTTGGATATGAA |
NCBI RefSeq | NM_025940 |
Alternative Names | Gm10128 |
Titer | >1*10^10 GC/mL |