shRNA Lentivirus (self-inactivating), p7SK-(FANCI-shRNA-Seq2)(CAT#: LV-SI1341WQ)
This product is a FANCI-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | FANCI-shRNA-Seq2 |
Related Target/Protein | FANCI |
Region | CDS |
TargetSeq | CCATTACAATTCTGTCGCCAA |
NCBI RefSeq | NM_018193 |
Alternative Names | KIAA1794 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA Damage |