shRNA Lentivirus (self-inactivating), pH1-(GAGE4-shRNA-Seq2)(CAT#: LV-SI0949WQ)
This product is a GAGE4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The GAGE4 gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The expression of GAGE4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | GAGE4-shRNA-Seq2 |
Related Target/Protein | GAGE4 |
Region | CDS |
TargetSeq | GTACAGCCTCCTGAAATGATT |
NCBI RefSeq | NM_001474 |
Alternative Names | CT4.4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast Cancer |