shRNA Lentivirus (self-inactivating), pH1-(GEMIN8-shRNA-Seq2)(CAT#: LV-SI0671WQ)

This product is a GEMIN8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by GEMIN8 gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The expression of GEMIN8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GEMIN8-shRNA-Seq2
Related Target/Protein GEMIN8
Region CDS
TargetSeq CCTCAGTCCTTCTATGACCAT
NCBI RefSeq NM_017856
Alternative Names FAM51A1
Titer >1*10^10 GC/mL
Related Diseases Survival motor neuron (SMN)
Target Gene
Gene ID 54960
Uniprot ID Q9NWZ8

Related Products