shRNA Lentivirus (self-inactivating), pH1-(GEMIN8-shRNA-Seq2)(CAT#: LV-SI0671WQ)
This product is a GEMIN8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by GEMIN8 gene is part of the SMN complex, which is necessary for spliceosomal snRNP assembly in the cytoplasm and pre-mRNA splicing in the nucleus. The expression of GEMIN8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | GEMIN8-shRNA-Seq2 |
Related Target/Protein | GEMIN8 |
Region | CDS |
TargetSeq | CCTCAGTCCTTCTATGACCAT |
NCBI RefSeq | NM_017856 |
Alternative Names | FAM51A1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Survival motor neuron (SMN) |