shRNA Lentivirus (self-inactivating), pH1-(GLOD4-shRNA-Seq1)(CAT#: LV-SI0643WQ)

This product is a GLOD4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GLOD4-shRNA-Seq1
Related Target/Protein GLOD4
Region 3UTR
TargetSeq CCCTCTTACTTGCTTTCACAT
NCBI RefSeq NM_016080
Alternative Names HC71; CGI-150; C17orf25
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 51031
Uniprot ID Q9HC38

Related Products