shRNA Lentivirus (self-inactivating), pH1-(Hsph1-shRNA-Seq6)(CAT#: LV-SI2820WQ)

This product is a Hsph1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Hsph1-shRNA-Seq6
Related Target/Protein Hsph1
Region 3UTR
TargetSeq GCTAGTGAACTGTAGCAGCAT
NCBI RefSeq NM_013559
Alternative Names HSP105; HSP105A; HSP105B; NY-CO-25
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 10808
Uniprot ID Q92598

Related Products