shRNA Lentivirus (self-inactivating), pH1-(KIAA0802-shRNA-Seq3)(CAT#: LV-SI0684WQ)

This product is a KIAA0802-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert KIAA0802-shRNA-Seq3
Related Target/Protein KIAA0802
Region CDS
TargetSeq CCAAGTTTGAACGCACATGCT
NCBI RefSeq NM_015210
Alternative Names SOGA2; CCDC165; MTCL1
Titer >1*10^10 GC/mL
Related Diseases Microtubules (MTs) growth
Target Gene
Gene ID 23255
Uniprot ID Q9Y4B5

Related Products