shRNA Lentivirus (self-inactivating), pH1-(Ktn1-shRNA-Seq4)(CAT#: LV-SI2598WQ)
This product is a Ktn1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Ktn1-shRNA-Seq4 |
Related Target/Protein | Ktn1 |
Region | 3UTR |
TargetSeq | GCCAAATTAAAGCCTTATTTA |
NCBI RefSeq | NM_008477 |
Alternative Names | CG1; KNT; MU-RMS-40.19 |
Titer | >1*10^10 GC/mL |